|
Post by skyship on Feb 21, 2011 18:38:31 GMT -5
Definition of VOLUTIN : a granular basophilic substance containing nucleic acids that is found especially in cells of microorganisms Origin of VOLUTIN German, from New Latin volutans, specific epithet of the bacterium Spirillum volutans in which it was first found First Known Use: 1908 www.merriam-webster.com/dictionary/volutin==================== spirillum volutans in the T3SS and T4SS??
Wow..........lots of STUFF here:=========== mortada8.maktoobblog.com/category/histology/skyship
|
|
|
Post by skizit on Feb 21, 2011 23:16:11 GMT -5
This science is called MUTAGENESIS. The patents that tell how this can be done in vivo are held by the Scripps Institute. There is also a human aminoacyl-tRNA synthetase for which the patent was granted in Oct 2010. More than one kind of unnatural amino acid can be clicked in. I am listing the patents under my video on Synthetic systems and biology. The first patents were applied for as early as 2001 but not granted until 2003.
The research is paid for by the Dept of Energy, the same agency that developed the atomic bomb. Morgellons is our bomb and we are the innocent civilians. Funding and ownership is declared on the patents.
Also providing funding is the NAVY and National Institute of Health, agencies developing bioweapons.
|
|
|
Post by skizit on Feb 22, 2011 12:44:01 GMT -5
Somewhere up there I think we agree that Morgellons involves reengineering methods of crossing cell membranes, signaling pathways and unnatural amino acids.
Could you put into a couple of paragraphs a synopsis of what your research says about Morgellons?
From what I read and hear, the names we hear associated with Morgellons like Carnicom or Hildy, they don't have a clue or they know and are misleading people. Even the 5 doctors enlisted by the Holman Foundation don't have any idea what Morgellons is, i.e., people looking to them for help or guidance are wasting their time.
I am putting together a video with as much information regarding the amino acids I can squish in there. I would like to include the things that are important to get this information out there to people who need it.
|
|
|
Post by skyship on Feb 22, 2011 13:28:21 GMT -5
Skizit, You said, "Somewhere up there I think we agree that Morgellons involves reengineering methods of crossing cell membranes, signaling pathways and unnatural amino acids." ==================== nonnatural amino acids: the list: www.sigmaaldrich.com/chemistry/chemistry-products.html?TablePage=16274965Occurrence and functions in biochemistry A protein depicted as a long unbranched string of linked circles each representing amino acids. One circle is magnified, to show the general structure of an amino acid. This is a simplified model of the repeating structure of protein, illustrating how amino acids are joined together in these molecules. A polypeptide is an unbranched chain of amino acids.Standard amino acids See also: Protein primary structure and Posttranslational modification Amino acids are the structural units that make up proteins. They join together to form short polymer chains called peptides or longer chains called either polypeptides or proteins. These polymers are linear and unbranched, with each amino acid within the chain attached to two neighboring amino acids. The process of making proteins is called translation and involves the step-by-step addition of amino acids to a growing protein chain by a ribozyme that is called a ribosome.[21] The order in which the amino acids are added is read through the genetic code from an mRNA template, which is a RNA copy of one of the organism's genes. Twenty-two amino acids are naturally incorporated into polypeptides and are called proteinogenic or standard amino acids.[9] Of these, 20 are encoded by the universal genetic code. The remaining 2, selenocysteine and pyrrolysine, are incorporated into proteins by unique synthetic mechanisms. Selenocysteine is incorporated when the mRNA being translated includes a SECIS element, which causes the UGA codon to encode selenocysteine instead of a stop codon. Pyrrolysine is used by some methanogenic archaea in enzymes that they use to produce methane. It is coded for with the codon UAG, which is normally a stop codon in other organisms.... .........."Expanded genetic codeSince 2001, 40 non-natural amino acids have been added into protein by creating a unique codon (recoding) and a corresponding transfer-RNA:aminoacyl – tRNA-synthetase pair to encode it with diverse physicochemical and biological properties in order to be used as a tool to exploring protein structure and function or to create novel or enhanced proteins.en.wikipedia.org/wiki/Amino_acid========================== They are adding to the genetic code,................. ============ Expanding the genetic code via mutant aminoacyl tRNA synthetasesIn some of the aminoacyl tRNA synthetases, the cavity that holds the amino acid can be mutated and modified to carry artificial, unnatural amino acids synthesized in the lab, and to attach them to specific tRNAs. This expands the genetic code, beyond the twenty amino acids universal in nature, to include an unnatural amino acid as well. The unnatural amino acid is coded by an otherwise non-coding base triplet such as the amber stop codon. The organism that expresses the mutant synthetase can then be genetically programmed to incorporate the unnatural amino acid into any desired position in any protein of interest, allowing chemists to probe, or change, the protein's function. For instance, one can start with the gene for a protein that binds a certain sequence of DNA, and, by directing an unnatural amino acid with a reactive side-chain into the binding site, create a new protein that cuts the DNA at the target-sequence, rather than binding it. By mutating aminoacyl tRNA synthetases, chemists have expanded the genetic codes of various organisms to include lab-synthesized amino acids with all kinds of useful properties: photoreactive, metal-chelating, xenon-chelating, crosslinking, color-changing, spin-resonant, fluorescent, biotinylated, and redox-active amino acids. [3] en.wikipedia.org/wiki/Aminoacyl_tRNA_synthetase==================== I would say that synthetic amino acids make Morgellons happen.It is directed/forced evolution. In otherwords forcing adaptations. Not mutations, can only be done by viral components. ============ Dr. H mentions the esterase, this is important in the un natural amino acids. Cholinesterase found assoicated with Sencil. In latest article thread. So, I would not delete Dr. H's work, or Smith's or Wymores, or even Dr. Harvey: All relate in a compartmentalized way, the same way this was produced. It is not just one entity, it is a process. from organic cell creation to inorganic cell creation. skyship
|
|
|
Post by skyship on Feb 22, 2011 13:57:58 GMT -5
|
|
|
Post by skyship on Feb 22, 2011 14:12:04 GMT -5
en.wikipedia.org/wiki/Peter_G._Schultz========= An expanded genetic code refers to an artificially modified genetic code in which one or more specific codons have been allocated to encode an amino acid which is not among the twenty/twenty-two found in nature.[1] Directed evolution Several methods for selecting the synthetase which accepts only the non natural amino acid have been developed. One of which is by using a combination of positive and negative selectionSome amino acids which have been added in order to label protein This orthologous set can then be mutated and screened through directed evolution to accept a different, even novel, amino acid. Mutations to the plasmid containing the pair can be introduced by error-prone PCR or through degenerate primers for the synthetase's active site. Orthogonal synthetase:called NONSENSE mutants; you are right called mutants. Nonsense mutants: ============== Amber, ochre, and opal nomenclature Stop codons were historically given many different names, as they each corresponded to a distinct class of mutants that all behaved in a similar manner. These mutants were first isolated within bacteriophages (T4 and lambda), viruses that infect the bacteria Escherichia coli. Mutations in viral genes weakened their infectious ability, sometimes creating viruses that were able to infect and grow within only certain varieties of E coli.=============== Amber mutations were the first set of nonsense mutations to be discovered, isolated by graduate student Harris Bernstein in experiments designed to resolve a debate between Richard Epstein and Charles Steinberg. Bernstein (whose last name means "amber" in German) had been offered the reward of having any discovered mutants named after himself.[3] Viruses with amber mutations are characterized by their ability to infect only certain strains of bacteria, known as amber suppressors. These bacteria carry their own mutation that allow a recovery of function in the mutant viruses. For example, a mutation in the tRNA that recognizes the amber stop codon allows translation to "read through" the codon and produce full-length protein, thereby recovering the normal form of the protein and "suppressing" the amber mutation. Thus, amber mutants are an entire class of virus mutants that can grow in bacteria that contain amber suppressor mutations. Can also be placed with other viruses. ochre mutation was the second stop codon mutation to be discovered. Given a color name to match the name of amber mutants, ochre mutant viruses had a similar property in that they recovered infectious ability within certain suppressor strains of bacteria. The set of ochre suppressors was distinct from amber suppressors, so ochre mutants were inferred to correspond to a different nucleotide triplet. Through a series of mutation experiments comparing these mutants with each other and other known amino acid codons, Sydney Brenner concluded that the amber and ochre mutations corresponded to the nucleotide triplets "UAG" and "UAA".[4]opal mutations or umber mutations the third and last stop codon in the standard genetic code was discovered soon after, corresponding to the nucleotide triplet "UGA".[5] Nonsense mutations that created this premature stop codon were later called opal mutations or umber mutations. In the standard genetic code, there are several stop codons: * in RNA: o UAG ("amber") o UAA ("ochre") o UGA ("opal") * in DNA: o TAG ("amber") o TAA ("ochre") o TGA ("opal" or "umber"). See also: variations. Mnemonic UGA: "U Go Away" UAA: "U Are Away" UAG: "U Are GoneThe UGA codon has recently been identified as the codon coding for Selenocysteine (Sec). This amino acid is found in 25 selenoproteins where it is located in the active site of the protein. Transcription of this codon is enabled by proximity of the SECIS element (SElenoCysteine Incorporation Sequence).[2] The UAG codon can translate into pyrolysin in a similar way selenocysteine is encoded. en.wikipedia.org/wiki/Stop_codon======================= Schultz Lab =============== The possibility of reassigning codons was realized by Normanly et al. in 1990 when a viable mutant strain of E. coli read through the amber (stop) codon.[2] As a result the amber codon became the choice codon to be assigned a novel amino acid. Later, in the Schultz lab the tRNATyr/tyrosyl-tRNA synthetase (TyrRS) from Methanococcus jannaschii was used to introduce a tyrosine instead of STOP, the default value of the amber codon.[3] As mentioned, this was possible because of the differences between the endogenous bacterial synthases and the orthologous archeal synthase which do not recognise each other.en.wikipedia.org/wiki/Expanded_genetic_code#Directed_evolution================= example: tRNATyr/tyrosyl-tRNA synthetase (TyrRS) ========== EXPANDING THE GENETIC CODEAnnual Review of Biophysics and Biomolecular Structure Vol. 35: 225-249 (Volume publication date June 2006) First published online as a Review in Advance on January 13, 2006 DOI: 10.1146/annurev.biophys.35.101105.121507 Lei Wang,1 Jianming Xie,2 and Peter G. Schultz21The Jack H. Skirball Center for Chemical Biology & Proteomics, The Salk Institute for Biological Studies, La Jolla, California 92037 2Department of Chemistry and The Skaggs Institute for Chemical Biology, The Scripps Research Institute, La Jolla, California 92037; Recently, a general method was developed that makes it possible to genetically encode unnatural amino acids with diverse physical, chemical, or biological properties in Escherichia coli, yeast, and mammalian cells. More than 30 unnatural amino acids have been incorporated into proteins with high fidelity and efficiency by means of a unique codon and corresponding tRNA/aminoacyl-tRNA synthetase pair. These include fluorescent, glycosylated, metal-ion-binding, and redox-active amino acids, as well as amino acids with unique chemical and photochemical reactivity. This methodology provides a powerful tool both for exploring protein structure and function in vitro and in vivo and for generating proteins with new or enhanced properties.www.annualreviews.org/doi/abs/10.1146/annurev.biophys.35.101105.121507
|
|
|
Post by skyship on Feb 22, 2011 15:10:10 GMT -5
schultz.scripps.edu/research.phptRNA/aminoacyl-tRNA synthetase pair. Abstract Top A previously engineered Methanocaldococcus jannaschii –tyrosyl-tRNA synthetase pair orthogonal to Escherichia coli was modified to become orthogonal in mammalian cells. The resulting -tyrosyl-tRNA synthetase pair was able to suppress an amber codon in the green fluorescent protein, GFP, and in a foldon protein in mammalian cells. The methodology reported here will allow rapid transformation of the much larger collection of existing tyrosyl-tRNA synthetases that were already evolved for the incorporation of an array of over 50 unnatural amino acids into proteins in Escherichia coli into proteins in mammalian cells. Thus we will be able to introduce a large array of possibilities for protein modifications in mammalian cells. www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0011263We are up to 50 here........what are those 50? 50 unnatural amino acids into proteins in Escherichia coli into proteins in mammalian cells SKIZIT, here is patent for mammalian cells. www.freepatentsonline.com/y2010/0021963.htmlskyship
|
|
|
Post by skyship on Feb 22, 2011 17:48:17 GMT -5
Skizit,
You might want to get the whole package for your video.
This covers much of the Expanded code. I would go with that rather than mutagenesis, was used in past, but not now. Has been put in e-coli. www.scq.ubc.ca/changing-the-language-of-dna/============ the tRNA brings the amino acid to the ribosome, mRNA ribosome is involved,
picture of form...........==== mRNA to Protein: the Translational Machinery
Translation is the process where mRNA is read and translated into a string of amino acids. This process takes place at organelles called ribosomes, which bind and slide along the mRNA and serve as a framework for translating the genetic message. As each triplet codon is read (for example AGC), a transfer RNA (tRNA) molecule brings a specific amino acid to the ribosome, and this amino acid is then chemically joined to the previous amino acid by a peptide bond. Basically, these tRNA molecules are like waiters. Each is trained to take a specific order from a certain triplet codon and fetch the amino acid corresponding to that order. On one arm of the ‘T’ is an anticodon loop containing the complimentary triplet codon (for ACG, it would be UGC) to that on the mRNA. On another arm is an acceptor stem that attaches to the amino acid corresponding to the triplet codon (in this case serine). After the tRNA molecule delivers its amino acid to the translation complex, it floats away to be recharged with another amino acid. This is done by enzymes called aminoacyl-tRNA synthetases (ARS), which recognize both the anticodon loop and acceptor stem of tRNAs and attach the corresponding amino acid. These ARSs essentially ensure that the tRNA waiters pick up the right order. After the string of amino acids is transcribed, it is folded and modified to become a protein. So why would anyone want to alter the language of genetic information? The answer lies with our need to study proteins and the cellular processes for which they are responsible. An expanded genetic code allows for the incorporation of unnatural amino acids into proteins, opening the door to previously unavailable experimental methods. Although mutating DNA through site-directed mutagenesis has long been used to exchange one natural amino acid for another, this approach is limited to exchange between properties found in nature. For instance, the amino acid asparagine, which is polar, can be exchanged for leucine, which is not. Unnatural amino acids, however, can be created with properties that can serve as novel tools in protein study [2]. Here are a few possibilities:- Biophysical Probes: Modified amino acids containing fluorescent groups can be used to visualize protein localization and protein-protein interactions within a cell. Amino acids with synthetically added modifications, like phosphorylated or glycosylated side chains, may also be used to study the effect of these natural intracellular modifications on protein structure and function.- Photoreactive Groups: Amino acids with photoreactive groups can be used as a light-i nduced trigger that can activate a certain protein function. Studies have used ‘caged’ sidechains that hide reactive or important parts of a protein. Photodecaging then serves as a way to ‘turn on’ the system for study. - Stuctural Labels: Heavy atoms or spin labels can be used in methods used for structural studies such as spectroscopy, NMR, and crystallography.========================= These are not mutations they are additional............... in the Extracellular matrix............between cells. if you know what I mean.
ARS are the enzymes called aminoacyl-tRNA synthetases============================= So, in essence what we have is two DNa systems in the body now.
The original dna cannot be changed, but, additions can make a new dna system, so they can be read and transcribed, for a cell free system, would be inorganic or artificial or synthetic.
==================== What you could do is find out what was used for the 50 additional amino acids............ =================== For instance Alkynes were used. www.freepatentsonline.com/7888063.htmlskyship
|
|
|
Post by lilsissy on Feb 22, 2011 17:58:00 GMT -5
Yes, Cholinesterase found assoicated with Sencil. Cholinesterase I just seen this for the first time Sky, this looks interesting, -------------------------------------------------------------------------------- NTERMEDIATE FILAMENTS: Molecular Structure, Assembly Mechanism, and Integration Into Functionally Distinct Intracellular Scaffolds The superfamily of intermediate filament (IF) proteins contains at least 65 distinct proteins in man, which all assemble into 10 nm wide filaments and are principal structural elements both in the nucleus and the cytoplasm with essential scaffolding functions in metazoan cells. At present, we have only circumstantial evidence of how the highly divergent primary sequences of IF proteins lead to the formation of seemingly similar polymers and how this correlates with their function in individual cells and tissues. Point mutations in IF proteins, particularly in lamins, have been demonstrated to lead to severe, inheritable multi-systemic diseases, thus underlining their importance at several functional levels. Recent structural work has now begun to shed some light onto the complex fine tuning of structure and function in these fibrous, coiled coil forming multidomain proteins and their contribution to cellular physiology and gene regulation. www.annualreviews.org/doi/abs/10.....nalCode=biochemINTERMEDIATE FILAMENTS and dynein substitutes. Chlamydomonas Inner-Arm Dynein Mutant, ida5, Has a Mutation in an Actin-encoding Gene www.ncbi.nlm.nih.gov/pmc/articles/PMC2139884/====== php.med.unsw.edu.au/cellbiology/index.php?title=2009_Group_10_Project================= php.med.unsw.edu.au/cellbiology/i....t_structure.jpgvimentin: www.nordiqc.org/Epitopes/vimentin/vimentin.htmlamin A www.dmd.nl/lmna_home.html=================== Dna primers: note the forward primer is M13............ the nanowire. we are the wireless connection to the computer............................. www.dmd.nl/LMNA_primers.htmlskyship
|
|
|
Post by skyship on Feb 22, 2011 18:05:07 GMT -5
Cholinesterase: Environmental Medicine,,use of the e-coli synthetic amino acids? www.atsdr.cdc.gov/csem/cholinesterase/pam_medications.htmlcdc might kick about again? ? ====== Case Studies in Environmental Medicine (CSEM) Cholinesterase Inhibitors Including Insecticides and Chemical Warfare Nerve Agents Part 4: The Cholinergic Toxidrome Section 11: Management of the Cholinergic Toxidrome Management Strategy 3: Medications 2-PAM (2-Pyridine Aldoxime Methylchloride) (Pralidoxime) Figures 14-18 below show how a cholinesterase inhibitor (in this case, a nerve agent) attaches to the serine hydroxyl group on acetylcholinesterase. This prevents acetylcholine from interacting with the cholinesterase enzyme and being broken down.www.atsdr.cdc.gov/csem/cholinesterase/pam_medications.html===================== This is exactly what DR. H. said when found cholinesterase associated with the SENCIL, which causes a chemical reaction. What is SENCIL made of? ==================== Acetylcholinesterase: An enzyme that breaks down the neurotransmitter acetylcholine at the synaptic cleft (the space between two nerve cells) so the next nerve impulse can be transmitted across the synaptic gap. Pesticides of the organophosphate and carbamate types act to paralyze and kill insects by inhibiting their acetylcholinesterase. Abbreviated AChE. www.medterms.com/script/main/art.asp?articlekey=23279=============== breaking this down some more: organophosphate and carbamate academic.scranton.edu/faculty/CANNM1/biochemistry/biochemistrymodule.htmlWhat is green chemistry all about? organic or inorganic, is it artificial? or real? skyship
|
|
|
Post by skyship on Feb 22, 2011 21:27:35 GMT -5
I must have lost that post on web somewhere, seems long time ago...... this one seems to indicate the chlamydia species reinhardii INTERMEDIATE FILAMENTS and dynein substitutes. Chlamydomonas Inner-Arm Dynein Mutant, ida5, Has a Mutation in an Actin-encoding Gene www.ncbi.nlm.nih.gov/pmc/articles/PMC2139884/ida5 and arp2/3? cytoskeleton again. We may find an locanate Carnicom's chlamydia after all............ seems this is the same one the Indian Scientist found, and said "did they not know it had mitochondria?"....... =======
|
|
|
Post by skyship on Feb 27, 2011 14:34:05 GMT -5
Patents: www.freepatentsonline.com/y2003/0082575.htmlwww.freepatentsonline.com/7811801.html Dendrimers and methods for their preparation and use www.freepatentsonline.com/y2003/0077635.html============ www.freepatentsonline.com/y2008/0213231.htmlAntimicrobial zeolite and antimicrobial resin compositionwww.freepatentsonline.com/y2007/0110825.htmlRelated US Applications:Dopaminergic Nurr1-positive neuron stem cells, pharmaceutical composition therefor, and methods for isolation, culture and preservation thereofYang - March, 2006 - 20060046293 www.freepatentsonline.com/y2006/0046293.html===================== Flavonoids-rich tissue from Belamcanda chinensis and methods for culturing the sameUnited States Patent Application 20080311634 The present invention provides an in vitro flavonoid-rich tissue of Belamcanda chinensis, which is produced in a tissue culture system using a B. chinensis tissue capable of proliferation, such as a seed, an embryo of said seed, a root, a leaf, a base of a leaf, or a young inflorescence of B. chinensis. The preferred in vitro flavonoid-rich tissue is a callus tissue or an fast-proliferated roots of B. chinensis which contain a very high content of flavonoid as compared to the wild type B. chinensis. The present invention further provides a method for inducing the formation of the callus tissue and the fast-proliferated roots of B. chinensis. It also provides a method for extracting the flavonoids and a quantitative method for determining the amount of total flavonoids from the in vitro flavonoid-rich tissue. www.freepatentsonline.com/y2008/0311634.html=========================== CROP GRAIN FILLING GENE GIF1 AND THE APPLICATIONS THEREOFUnited States Patent Application 20100064385 A novel crop grain filling gene (GIF1) and the applications thereof are presented in the invention. The GIF1 gene can be applied to control grain filling, enhance crop yield or quality, or improve disease resistance or storage stability of crop grains. A method for improving crops is also presented in the invention. The GIF1 gene shows valuable potentials in controlling crop yield, quality, storage, and resistance to diseases. www.freepatentsonline.com/y2010/0064385.html=================== ===================== gymnosperm? ? Method for producing somatic embryos of pine trees (genus pinus) The invention consists of a new method for obtaining gymnosperm mature somatic embryos, based on chilling treatment and suspension cultures to preserve the embryogenic capacity of immature somatic embryos. The method consists in applying to immature somatic embryos a chilling preservation in liquid medium treatment for as long as a year; afterwards, reinitiation and proliferation are carried out, as well as reduction of proliferation rates, in order to optimize response to maturation promoters, and finally, the maturation of developing somatic embryos. With the exception of the last step, all of the process is carried out through suspension cultures. Embryo germination and plant development were performed by conventional techniques. www.freepatentsonline.com/y2003/0182696.html===================== Method for repairing a damaged portion of a human organ Elia - April, 2004 - 20040071637 Formulations Based on 3-Iodo-2-Propynyl Butyl Carbamate Bernardini et al. - August, 2008 - 20080206295 METHOD FOR PRODUCING SHAPED BODIES BASED ON CROSSLINKED GELATINE Ahlers - April, 2007 - 20070077274 Related US Applications:Antimicrobial zeolite and antimicrobial resin compositionTaniguchi et al. - May, 2007 - 20070110825 Prosthetic implants including ECM composite material Hiles - September, 2006 - 20060210597 Morinda citrifolla based antifungal formulations and methods Isami et al. - August, 2005 - 20050181082 Related US Applications:Oxygen-absorbing agent in the form of a pourable granulate Brandsch - November, 2004 - 20040235130 Pluripotent Stem Cell Cloned From Single Cell Derived From Skeletal Muscle Tissue Oh et al. - September, 2008 - 20080213231 Modulation of glucose transporter-4 expression Ward et al. - May, 2004 - 20040101848 MICROBIAL REDUCTIVE DEHALOGENATION OF VINYL CHLORIDE Spormann et al. - July, 2009 - 20090176210 Analyzing CGH data to identify aberrations Kincaid et al. - February, 2007 - 20070031883 Stem cell-based methods for identifying and characterizing agents Rubin et al. - January, 2005 - 20050019801 ANALYTICAL METHOD FOR ANALYZING C-TERMINUS TRUNCATION Rossi et al. - December, 2009 - 20090311732 US Patent References: In vivo incorporation of unnatural amino acids Schultz et al. - May, 2006 - 7045337 Methods and compositions for the production of orthogonal tRNA-aminoacyltRNA synthetase pairs Schultz et al. - June, 2003 - 20030108885 In vivo incorporation of unnatural amino acids Schultz et al. - May, 2003 - 20030082575 Lets dig...................and find....................exact constructions. Skyship
|
|
|
Post by aqt on Feb 27, 2011 15:06:47 GMT -5
|
|
|
Post by aqt on Feb 27, 2011 15:08:32 GMT -5
|
|
|
Post by aqt on Feb 27, 2011 15:09:24 GMT -5
www.ncbi.nlm.nih.gov/pubmed/17455182Influence of different ECM mimetic peptide sequences embedded in a nonfouling environment on the specific adhesion of human-skin keratinocytes and fibroblasts on deformable substratesHHHHHHMMMMMMMMMMMMMMMMMMMMMMMMMMM The peptide sequences mimic fibronectin, laminin, and collagen type IV, three major components of the ECM. To achieve this, PDMS is activated using ammonia plasma and coated with star-shaped isocyanate-terminated poly(ethylene glycol)-based prepolymers, which results in a functional coating that prevents unspecific cell adhesion. Specific cell adhesion is achieved by functionalization of the layers with the peptide sequences in different combinations. Moreover, a method that enables the decoration of deformable substrates with cell-adhesion peptides in extremely defined nanostructures is presented. The distance and clustering of cell adhesion molecules below 100 nm has been demonstrated to be of utmost importance for cell adhesion. Thus we present a new toolbox that allows for the detailed analysis of the adhesion of human-skin-derived cells on structurally and biochemically decorated deformable substrates.
|
|
|
Post by aqt on Feb 27, 2011 15:58:59 GMT -5
|
|
|
Post by aqt on Feb 27, 2011 16:08:15 GMT -5
peptide mimetics www.providpharma.com/Pubs/Provid_Peptide_Mimetics.pdf Peptide Mimetic - A peptide that biologically mimics active determinants on hormones, cytokines, enzyme substrates, viruses or other bio-molecules, and may antagonize, stimulate, or otherwise modulate the physiological activity of the natural ligands. Peptide mimetics are especially useful in drug development.
|
|
|
Post by aqt on Feb 27, 2011 16:10:17 GMT -5
|
|
|
Post by skyship on Feb 27, 2011 19:24:58 GMT -5
Will wade through the patents and pull out what could pertain to Morgellons type fibers, ribbons and ribosomes, amino acids..........
stick to the orthogonal............. .the unnatural amino acids, tRNA-aminoacyltRNA synthetase pairs dendrimers........
These Skizit has mentioned, plus others found within the other patents. down the rabbit hole!===== 1. US Patent References: In vivo incorporation of unnatural amino acidsSchultz et al. - May, 2006 - 7045337 The Patent:www.freepatentsonline.com/y2003/0082575.html------------- article: note authors: tRNA-mediated protein engineeringKenneth J Rothschild a, b, E-mail The Corresponding Author and Sadanand Giteb, c a 590 Commonwealth Avenue, Department of Physics, Boston USA b Physics Department, Molecular Biophysics Laboratory and Photonics Center, Boston University, Boston, MA 02215, USA c University, Boston, MA 02215, USA Available online 2 June 1999. AbstractNovel methods of incorporating non-native amino acids and stable isotope labels into proteins using modified tRNAs present new opportunities for basic research and biotechnology that go beyond conventional site-directed mutagenesis. tRNA-mediated protein engineering relies on the development of novel tRNAs and their misacylation with custom-designed amino acids, the recognition of special codons by the tRNAs, and the efficient expression of these modified proteins. Recent progress has been made in all these areas, including the development of more effective suppresor tRNAs and higher yield translation systems, leading to a variety of novel applications. Nomenclature DHFR dihydrofolate reductase FTIR Fourier transform infrared NAAR non-native amino acid replacement p-F-Phe p-fluoro-phenylalanineSDIL site-directed isotope labeling SNAAR site-directed NAAR TRAMPE tRNA-mediated protein engineeringtinyurl.com/45l2g4x========================================= ======================================================== 2. Methods and compositions for the production of orthogonal tRNA-aminoacyltRNA synthetase pairsSchultz et al. - June, 2003 - 20030108885 www.freepatentsonline.com/y2003/0108885.html================================== ========================= 3.
Dendrimers and methods for their preparation and usewww.freepatentsonline.com/y2003/0077635.html=============================== ====================================== 4. Site-specific incorporation of redox active amino acids into proteins www.freepatentsonline.com/7811801.html=========================== -------------------------------------------- 5. Design and construction of dimeric concanavalin a mutants Embodiments of the invention provide for compositions comprising purified polypeptides such as purified Concanavalin A (ConA) mutants. In addition, e mbodiments provide for polypeptides and nucleic acids encoding those polypeptides, such as mutant ConA with reduced dimer-dimer interactions compared to wild type ConA. Some embodiments also provide for sensors comprising the polypeptides disclosed herein. The embodiments also provide an improved method of producing recombinant mutant ConA. www.freepatentsonline.com/y2007/0207498.html==================== ========================== 6. PLANT TRANSFORMATION WITHOUT SELECTIONUnited States Patent Application 20080057512 The invention provides methods for identifying regenerated transformed plants and differentiated transformed plant parts, obtained without subjecting plant cells to selective conditions prior to regenerating the cells to obtain differentiated tissues. In particular embodiments, the plant cells are corn plant cells. Methods for growing and handling plants, including identifying plants that demonstrate specific traits of interest are also provided. www.freepatentsonline.com/y2008/0057512.html================== ==================================== Now lets take these 6 and examine them. Skyship
|
|
|
Post by skyship on Feb 27, 2011 20:11:21 GMT -5
1. What is claimed is:1. A composition comprising a translation system, the translation system comprising an orthogonal tRNA (O-tRNA) and an orthogonal aminoacyl tRNA synthetase (O-RS), wherein the O-RS preferentially aminoacylates the O-tRNA with at least one unnatural amino acid in the translation system and the O-tRNA recognizes at least one selector codon. Now what does this mean?
orthogonal tRNA ,O-tRNA================ Engineering of an orthogonal aminoacyl-tRNA synthetase for efficient incorporation of the non-natural amino acid O-methyl-L-tyrosine using fluorescence-based bacterial cell sorting.We describe a strategy for the rapid selection of mutant aminoacyl-tRNA synthetases (aaRS) with specificity for a novel amino acid based on fluorescence-activated cell sorting of transformed Escherichia coli using as reporter the enhanced green fluorescent protein (eGFP) whose gene carries an amber stop codon (TAG) at a permissive site upstream of the fluorophore. To this end, a one-plasmid expression system was developed encoding an inducible modified Methanocaldococcus jannaschii (Mj) tyrosyl-tRNA synthetase, the orthogonal cognate suppressor tRNA, and eGFP(UAG) in an individually regulatable fashion. Using this system a previously described aaRS with specificity for O-methyl-L-tyrosine (MeTyr) was engineered for 10-fold improved incorporation of the foreign amino acid by selection from a mutant library, prepared by error-prone as well as focused random mutagenesis, for MeTyr-dependent eGFP fluorescence. www.ncbi.nlm.nih.gov/pubmed/20837025~~~~~~~~~~~~~~~~~~~~~~ Noun 1. tRNAtRNA - RNA molecules present in the cell (in at least 20 varieties, each variety capable of combining with a specific amino acid) that attach the correct amino acid to the protein chain that is being synthesized at the ribosome of the cell (according to directions coded in the mRNA) acceptor RNA, soluble RNA, transfer RNA ribonucleic acid, RNA - (biochemistry) a long linear polymer of nucleotides found in the nucleus but mainly in the cytoplasm of a cell where it is associated with microsomes; it transmits genetic information from DNA to the cytoplasm and controls certain chemical processes in the cell; "ribonucleic acid is the genetic material of some virusesacceptor RNA ribonucleic acid RNA soluble RNA transfer RNA tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate Scripps Research Institute obtains United States patent by BIOTECH Patent News1963), indicating that the tRNA aminoacylation event by aminoacyl-tRNA synthetases (aaRSs), and not the Ribosomal synthesis of nonstandard peptides (1) by Kang Taek Jin; Suga, Hiroaki / Biochemistry and Cell Biologyribosomal decoding, binding of antibiotics to the aminoacyl-tRNA site of bacterial Aminoglycoside antibiotics; from chemical biology to drug discovery by SciTech Book News www.thefreedictionary.com/Aminoacyl-tRNA~~~~~~~~~~~~~~~~~~~~~~~~~
orthogonal aminoacyl tRNA synthetase. O-RSwww.uspto.gov/web/patents/patog/week19/OG/html/1354-2/US07713721-20100511.htmlwww.faqs.org/patents/app/20090197339============================= selector codonip.com/patent/US7713721 Codon tableopenwetware.org/wiki/Codon_tableskyship
|
|
|
Post by skyship on Feb 27, 2011 21:41:19 GMT -5
inducible modified Methanocaldococcus jannaschii (Mj) tyrosyl-tRNA synthetase,| Encoding unnatural amino acids in prokaryotes.www.nature.com/nrm/journal/v7/n10/fig_tab/nrm2005_F1.html========================== Positive/negative selection.......... what does that mean?---------
One Plasmid Selection System for the Rapid Evolution of Aminoacyl-tRNA Synthetases We have developed a rapid, straightforward, one plasmid dual positive/negative selection system for the evolution of aminoacyl-tRNA synthetases with altered specificities in E. coli. T his system utilizes an amber stop codon containing a chloramphenicol acetyltransferase/uracil phosphoribosyltransferase fusion gene. We demonstrate the utility of the system by identifying a variant of the M. jannaschii tyrosyl synthetase from a library of 109 variants that selectively incorporates para-iodophenylalanine in response to an amber stop codon. To date, more than 40 unnatural amino acids have been site-specifically incorporated into proteins directly in living organisms using orthogonal tRNA/aminoacyl-tRNA synthetase (aaRS) pairs.1–8 The majority of these have been incorporated in E. coli by directed evolution of an M. jannaschii tyrosyl-tRNA synthetase (MjYRS)/tRNACUA-derived pair which is orthogonal to the tRNAs and aaRSs in bacteria. The evolution process involves subjecting a library of plasmid-borne aminoacyl-tRNA synthetase variants, created by site-saturation mutagenesis of the amino acid binding pocket, to a series of positive and negative selections. The positive selection is carried out using a selection vector containing the amber suppressor tRNA and a chloramphenicol acteyltransferase (CAT) gene with an amber stop codon at a permissive site. Selection on chloramphenicol (Cm) in the presence of the unnatural amino acid enriches aaRS variants capable of incorporating either the unnatural amino acid or an endogenous amino acid. Negative selection utilizes a vector containing the tRNA and an arabinose-inducible gene encoding the toxic ribonuclease barnase with three amber stop codons at permissive sites; growth in the presence of arabinose eliminates those aaRS variants which recognize endogenous amino acids.1 A typical selection requires t hree rounds of positive and negative selection to obtain synthetase variants with the desired activity.www.ncbi.nlm.nih.gov/pmc/articles/PMC2714362/===================== This is Forced/directed EVOlUTION. ....... ================================ Complete set of orthogonal 21st aminoacyl-tRNA synthetase-amber, ochre and opal suppressor tRNA pairs: concomitant suppression of three different termination codons in an mRNA in mammalian cells human initiator:. Previously, we described orthogonal 21st aaRS-amber suppressor tRNA pair for use in mammalian cells based on E.coli GlnRS and amber suppressor tRNAs derived from E.coli tRNAGln (15) and the human initiator tRNAMet www.ncbi.nlm.nih.gov/pmc/articles/PMC535668/==== Methanococcus janneschi ===================== human initiator tRNAMet what is it made of? Sulfolobus solfataricus~~~~~~~~~~~~~~~~~~~~~~ Sulfolobus solfataricus translation initiation factor 1 stimulates translation initiation complex formation.
D Hasenöhrl, D Benelli, A Barbazza, P Londei, U Bläsi The eukaryotic translation initiation factor 1 binds to the ribosome during translation initiation. It is instrumental for initiator-tRNA and mRNA binding, and has a function in selection of the authentic start codon. Here, we show that the archaeal homolog aIF1 has analogous functions. The aIF1 protein of the archaeon Sulfolobus solfataricus is bound to the small ribosomal subunit during translation initiation and accelerates binding of initiator-tRNA and mRNA to the ribosome. Accordingly, aIF1 stimulated translation of an mRNA in a S. solfataricus in vitro translation system. Moreover, this study suggested that the C terminus of the factor is of relevance for its function.
CRYSTAL STRUCTURES OF THE SMALL RIBOSOMAL SUBUNIT WITH TETRACYCLINE, EDEINE AND IF3 CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH EDEINE CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH THE TRANSLATION INITIATION FACTOR IF3 (C-TERMINAL DOMAIN)
this one:************************CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH TETRACYCLINE HUMAN TRANSLATION INITIATION FACTOR EIF1, NMR, 29 STRUCTURES Browse RNAi articles via key phrases: translation, mRNA, solfataricus, factor, initiator-tRNA, factor 1, aIF1, accelerates, terminus, relevance, ribosomal subunit, aIF1 protein, instrumental, ribosome, archaeal homolog aIF1, eukaryotic translation, archaeon Sulfolobus solfataricus, bound,Related Articles: * Elevated tRNA(iMet) synthesis can drive cell proliferation and oncogenic transformation. Cell Apr 08, 2008 ... inducible pol III-specific transcription factor, Brf1, allowed us to raise tRNA and 5S rRNA levels specifically. ... Brf1 impeded transformation. Among the gene products induced by Brf1 is the tRNA(iMet) that initiates polypeptide synthesis. Overexpression of ... * Survival from hypoxia in C. elegans by inactivation of aminoacyl-tRNA synthetases. Science Jan 30, 2009 ... encodes an arginyl-transfer RNA (tRNA) synthetase, an enzyme essential for protein translation. Knockdown of rrt-1, and ... of the reduction-of-function mutant of rrt-1. Thus, translational suppression produces hypoxia resistance, in part by reducing unfolded ... * Elongation factor 1a mediates the specificity of mitochondrial tRNA import in T. brucei. EMBO J Sep 14, 2007 ... the main antideterminant that prevents interaction with cytosolic elongation factor (eEF1a). Here we show that ablation of cytosolic eEF1a, but not of initiation factor 2, inhibits mitochondrial import of newly synthesized tRNAs well before translation or ... * mtRF1a Is a Human Mitochondrial Translation Release Factor Decoding the Major Termination Mol Cell Sep 06, 2007 ... , those required for translation termination. All other systems have two classes of release factors that either promote codon-specific hydrolysis of peptidyl-tRNA (class I) or lack specificity but stimulate the dissociation of class I ... * [b ]Genome-wide analysis of N1-methyl-adenosine modification in human tRNAs. RNA May 20, 2010 ... how A58 hypomodification affects stability and involvement of tRNAs in translation. Our microarray-based method detects the ... quite similar. In all cases, no hypomodified initiator-tRNA(Met) is detected, consistent with the requirement of this modification ... * A Role for TFIIIC Transcription Factor Complex in Genome Organization. Cell Jun 05, 2006 ... into neighboring euchromatic regions by recruiting transcription factor TFIIIC complex without RNA polymerase III (Pol ... -wide analysis reveals TFIIIC with Pol III at all tRNA genes, many of which cluster at pericentromeric heterochromatin domain boundaries. ...[/b] POL ! II AND III are in the Influenza A virion, and phages * Unconventional decoding of the AUA codon as methionine by mitochondrial tRNAMet with the anticodon f5CAU as revealed with a mitochondrial in vitro translation system. Nucleic Acids Res Jan 19, 2009 ... both AUG and AUA as methionine. By constructing an in vitro translation system from bovine liver mitochondria, we examined the decoding properties ... -acetylcytidine) and the bovine cytoplasmic initiator tRNA(Met) (anticodon CAU) translated only the AUG codon ... * Pathogenic mutations in antisense mitochondrial tRNAs. J Theor Biol Nov 16, 2010 ... , t hose recognized by their cognate amino acid's tRNA synthetase, and those forming relatively stable cloverleaves as ... tRNAs probably function routinely in translation and extend the tRNA pool (extension hypothesis); others do not (avoidance hypothesis). ...CLOVERLEAF>...................... the plus sign..
CLOVERLEAF PROJECT important here.... The aerosol spraying. CHEMTRAILS???
* Angiogenin cleaves tRNA and promotes stress-induced translational repression. J Cell Biol Mar 31, 2009 ... (S51A), which indicates the existence of an alternative pathway of translational control. In this paper, we show that arsenite, heat shock, or ultraviolet irradiation promotes transfer RNA (tRNA) cleavage and accumulation of tRNA-derived, stress-induced ... * Mitochondrial initiation factor 2 of Trypanosoma brucei binds imported formylated elongato J Biol Chem Apr 19, 2005 ... , is involved in translation elongation. Mitochondrial translation initiation depends on an initiator tRNA(Met) carrying a formylated methionine. This tRNA is then recognized by initiation factor 2, which brings it to ... ]MITO initiation factor 2 is from our TRYPANOSOMA BRUCEI the elongation factor???Your cells may live longer, but you will have Chagas, the protozoan in your cells. One with the insects, the earth, ONE EARTH< ONE HUMAN. Wrap your arms around the earth, become the earth, submit to Satan. * Genetic Evidence for a Noncanonical Function of Seryl-tRNA Synthetase in Vascular Development. Circ Res May 08, 2009 ... appear to be caused by increased cell proliferation but is dependent on vascular endothelial growth factor (Vegf) signaling. By positional cloning, we isolated seryl-tRNA synthetase (sars) as the gene affected by ... * Short hairpin type of dsRNAs that are controlled by tRNA(Val) promoter significantly induc Nucleic Acids Res Jan 15, 2003 ... -based loop were transported to the cytoplasm and were effectively processed. More over, tRNA-dsRNA directed against a mutant k-ras transcript ... the degradation of the normal k-ras mRNA in vitro and in vivo. Our tRNA-dsRNA technology should be a powerful tool ... * Impairment of the tRNA splicing endonuclease subunit 54 (tsen54) gene causes neurological abnormalities and larval death in zebrafish models of Pontocerebellar Hypoplasia. Hum Mol Genet Jan 28, 2011 ... mutations in the TSEN54 gene; one of four subunits comprising the tRNA-splicing endonuclease (TSEN) complex. We hypothesised ... rescued by co-injecting the morpholino with human TSEN54 mRNA. A developmental patterning defect was not associated with tsen54 ... * A new aminoacyl-tRNA synthetase-like protein in insecta with an essential mitochondrial function. J Biol Chem Sep 27, 2010 ... role in gene translation. Here we present a previously uncharacterized paralogue of seryl-tRNA synthetase named SLIMP ( ... it carries out an essential function that is unrelated to the aminoacylation of tRNA. The knock-down of SLIMP by RNA interference (RNAi) ... * Noncanonical Activity of Seryl-tRNA Synthetase Is Involved in Vascular Development. Circ Res May 08, 2009 Vascular endothelial growth factor (Vegf) plays central roles in the establishment of stereotypic vascular patterning in vertebrates. ... . The gene responsible for ko095 encodes seryl-tRNA synthetase (Sars) with a nonsense mutation. The abnormal branching of ... * Dr1 (NC2) is present at tRNA genes and represses their transcription in human cells. Nucleic Acids Res Dec 07, 2009 ... as is its dimerization partner DRAP1 (also called NC2alpha). Expression of tRNA by pol III is selectively enhanced by RNAi-mediated depletion of ... endogenous Dr1 and the pol III-specific transcription factor Brf1. This interaction may recruit Dr1 to pol III ..So the dimers are important in this tRNA.enter somatic cells, remember them? AQT?Enter prions...... * Combination of the somatic cell nuclear transfer method and RNAi technology for the production of a prion gene-knockdown calf using plasmid vectors harboring the U6 or tRNA promoter. Prion Nov 18, 2010 ... in the nervous tissues. These findings suggest that SCNT technology remains immature, that the tRNA promoter is useful, and that RNAi can significantly reduce PRNP mRNA levels, but insufficient reduction of PrPC ...
* Mitochondrial tRNA import in Trypanosoma brucei is independent of thiolation and the Rieske protein. RNA May 25, 2009 ... in the mitochondrial genome of Trypanosoma brucei, all tRNAs needed for mitochondrial translation have to be imported into the organelle from the cytosol. A ... 1) s(2)U is not a negative determinant for tRNA import; (2) the Rieske protein is not an essential ... * Allele Specific Suppressors of lin-1(R175Opal) Identify Functions of MOC-3 and DPH-3 in tRNA Modification Complexes in Caenorhabditis elegans. Genetics May 18, 2010 ... of lin-1(e1275) itself rather than the altered activity of a factor downstream of lin-1. We further showed that loss-of-function ... ELP complex is an evolutionarily conserved mechanism involved in tRNA functions that are important for accurate translation. * Pentatricopeptide repeat domain protein 1 lowers the levels of mitochondrial leucine tRNAs in cells. Nucleic Acids Res Aug 04, 2009 ... transcription in mammals have been described, the components involved in mRNA processing, translation and stability remain largely unknown ... increased the abundance precursor RNAs and of leucine tRNAs and PTCD1 overexpression led to a reduction of these RNAs ...Browse via Subject Heading: * Eukaryotic Initiation Factor-1 * Guanosine Triphosphate * Protein Biosynthesis * RNA, Archaeal * Ribosomes * Sulfolobus
Browse via Chemical and Biological Entity: * DNA Primers * Eukaryotic Initiation Factor-1 * RNA, Archaeal * Guanosine Triphosphate Cold Spring Harbor controls the directed/forced evolution called Epigenetics.Selection and Adaptation is name of the game! Acetylation -tRNA Amino acids Methylation histones 3 and 4 alterations Cytoskeletal actin adhesivesskyship
|
|
|
Post by skyship on Feb 27, 2011 22:25:42 GMT -5
A one plasmid system amino Acetyl - tRNA synthetase Translation system Primer system Acetylation system tRNA
Methylation system Methionine (pronounced /mɛˈθaɪ.ɵniːn/, /mɛˈθaɪ.ɵnɪn/; abbreviated as Met or M)[3] is an α-amino acid with the chemical formula HO2CCH(NH2)CH2CH2SCH3. This essential amino acid is classified as nonpolar. IS OUR PROTEIN M THIS METHIONINE? Histone system, tetramers and octomers
initiation factors... especially human tRNAmet
skyship
|
|
|
Post by lilsissy on Feb 28, 2011 0:22:59 GMT -5
I nominate the Human Brain Machine Patent that our Government has certain rights too. I will see if I can get a copy of it but it was not all. Man has many devices and many devices where necessary to improve and controll the built in flaws. Also the sencil was needed .... as explained below. Have you noticed all the pay phones are dissappearing??? And our sweet Government is giving poor folks free cell phones and radio waves. Oh and B.T.W. researchers have found a new opsin in our eyes. Brain Control by Viral Gene Fusion « Thread Started on Nov 11, 2009, 8:54am » -------------------------------------------------------------------------------- This is how genes put into a virus and given to us... affect us. www.youtube.com/watch?v=v7uRFVR9BPUThe sencil would suffice for the fiber optic tube sticking out of the mouses head. It is now our hair, it collects the frequencies.. Keratin collects light naturally too or so I recently read...dunno for sure. edboyden.org/07.08.opticalcontrol.comment.nytimes.pdfcut, proof that a new generation of genetic and optical technology can give researchers unprecedented power to turn on and off targeted sets of cells in the brain, and to do so by remote control. This virus can be put in Retinal cells which can then be put in us . Retinal cells are said to be in the H1N1 Vaccine, cut, And in Detroit, investigators at Wayne State University used blind mice lacking photoreceptors in their eyes and injected a virus carrying the channelrhodopsin gene into surviving retinal cells. Later, shining a light into the animals’ eyes, the scientists detected electrical signals registering in the visual cortex. But they are still investigating whether the treatment actually brings back vision, said Zhuo-Hua Pan, a neuroscientist. Tells how it can be done with a virus, www.wired.com/magazine/2009/10/mf_optigenetics/all/1Two Genes are used ChR2 and NhPR. Chamydomonas (ChR2) had been found in numerous Morgellons samples. This shows the human expression of the NhPR protein and how they get it into us. Optical Inhibition: Halorhodopsin (NpHR) The NpHR sequence here has been optimized for mammalian expression. The NpHR-EYFP inframe fusion genes are made via a NotI site with the linker GCGGCCGCC. The start codon on EYFP has been deliberately removed. To reduce membrane blebbing or other toxicity at high levels of expression, we have generated a modified eNpHR by adding signaling peptides to enhance membrane translocation and ER export. tinyurl.com/ya9n3ascut, Note: Due to ease of recombination, AAV and lentivirus vectors should be amplified in a recombination deficient bacteria strain such as Invitrogen's OneShot Stbl3 cells. Three point-mutants of humanized ChR2 convert a brief pulse of light into a stable step in membrane potential. The lentiviral vectors were created by site-directed mutagenesis of the C128 position in ChR2. All three mutants are activated by blue (470nm) light. Photocurrents generated by ChR2(C128A) and ChR2(C128S) can be effectively terminated by a pulse of green (542nm) light Hallow hair that was discovered by Mark Darrah Scientist. Reply 6. lymebusters.proboards.com/index.c....ad=10186&page=1 Only polar bears have hallow hair. Did Mark find of evidence of fiber optic's growing in Morgellon's Patient's. ami.usc.edu/projects/ami/projects/sencil/cut, The external end of the fiber will be attached to a photonic analyzer by means of a connector that accepts the free end of the fiber. The analyzer sends excitation light through the fiber to reach the biosensor element and receives returning fluorescent emissions from the biosensing element through the same fiber. This next article shows how they can use Invisible Radio waves instead of visible light for accessing our brain. www.nature.com/nrn/journal/v8/n8/full/nrn2192.htmlThe optical fibre can be coupled to a bright light source such as a diode laser16. Alternative solutions may involve high intensity light-emitting diodes (LEDs) the LEDs could even be powered wirelessly by radio frequency or magnetic induction. I believe I am finding some linkage between this system using these two genes that allow for the eletrically enhancement of animals and the H1N1 vaccine, The retinal cells mentioned in the next article may be related to this , they are light encoding cells , related to the former mentioned technology. Seems they have attached these Retinal cells to immortal cells (Mutated CANCER CELLS) to allow for endless duplication of cells that may be activated by light. Also polymers are being used in the H1N1 vaccine. www.elreporterosf.com/editions/?q=node/3785Now I will show that polymers can be absorbed throught the skin and grow right in our cells and are used by the government in Areial Scattering techniques. This thread shows how polymer can be absorbed throught the skin, lymebusters.proboards.com/index.c....ay&thread=12597Can be grown in our own cells, www.iop.org/EJ/abstract/1741-2552/4/2/L02cut, . Nano and microscale PEDOT filaments extend out from electrode sites, presumably forming within extracellular spaces. The cloud of PEDOT filaments penetrates out into the tissue far enough that it should be possible to bypass fibrous scar tissue and contact surrounding healthy neurons. These electrically functional, diffuse conducting polymer networks grown directly within tissue signify a new paradigm for creating soft, low impedance implantable electrodes. Are used in Government Spraying, tinyurl.com/yjyb2rncut, nanofibers and nanoporus absorbents will protect against CB threats while minimizing heat burdens and providing chameleon like color adaptation for chamouflage. The small size of the nanodevices will limit the volume,weight,and power burdens. .....we need new weapons for this war on insecurity. These are new scientific and technological areas that deal with structures the size of large individual molecules. These structures , roughly 50,000 times smaller than the width of a human hair cannot be seem or felt, ...... they are invisible, they are remarkably potent. ......this is not just the technology of tommarrow - nanotechnology applications are already reality. www.dtic.mil/cgi-bin/GetTRDoc?AD=ADA394560&Location=U2&doc=GetTRDoc.pdfThis is why we are wired , And this by IEEE EXPLORE, Conductive polymer "molecular wires" increase conductance across artificial cell membranes ieeexplore.ieee.org/xpl/freeabs_all.jsp?arnumber=1404205color=Yellow]Highly intimate contact between an electrode and a living neuron is strongly desired by both basic neuroscientists and engineers seeking to develop more effective neural prostheses[/color]. The net resistance between electrode and cell must be decreased in order to improve the quality of recordings and deliver the minimum necessary stimulating current specifically to the target cell. The ideal situation would be to establish chronic intracellular contact, bypassing the resistance of the cell membrane and the surrounding tissue. We present here evidence that regioregular polythiophene conductive polymers increase the electrical conductance of an artificial lipid bilayer that simulates a cell membrane. Our initial data on its behavior suggest that the polymer is freely diffusing within the lipid phase. This implies that these polymers, if tethered to a larger microelectrode, could permit long-term sustainable intracellular stimulation and recording. We therefore believe that this new molecule, when further developed, has the potential to significantly improve the performance of existing chronic electrode systems and possibly to enable new types of biosensors. This is where this all is heading, The HUMAN BRAIN MACHINE INTERFACE lymebusters.proboards.com/index.c....ay&thread=12467this shows the patent our Government has certain rights to and explains how they grow an artificial nervous system in our vascular bed . This matches the findings of Randy Wymore From he University of Oklahoma who found, in patient's that self diagnose as having Morgellons there exists a subcutaneous network of fibers that when teased out is a single fiber. www.youtube.com/watch?v=mfoidtKEpqc&feature=relatedThis fiber network attaches ot every brain neuron which can then be remotely access via the fiber optic hair to computer software resulting in, www.wired.com/wiredscience/2009/04/lasercontrolledhumans/
|
|
|
Post by skyship on Feb 28, 2011 2:00:26 GMT -5
You have that so right lilsis,
Kurzweil's dream. and seems Taylor and Francis, and Sanger, and Marie Curie, and Pasteur, Salk institute, HHMI, Jena Farms, Searle, Hammeroff, Venter, DOE, Dept of Commerce, Dept of Interior, WWF, Rockefeller U, John Hopkins, U of Ca, Cal Tech, U of chicago, U of Wi. many many more, all comparmentalization, but, all working on same goal. DARPA, DOD, all universities have a part, how they get the money, only if they work on the three important things. GNR
Genomics Nanotechnology Robotics Remember robotics will be nano.
Yep, we see it, and what is one to do. Do you control technology, or give it a free reign? I think, if the motto "First do no harm" would have prevented a multitude of errors that are now part of the risk factor. They knew there were going to be risks, yet, they moved ahead and put these probes, sensors, gfps, hyrbridizers, and synthetic dna, from the Influenza A, \was used as a mutator, to mutate the synthetic in. the amino acids, the methylation, the histone 3 and 4 changes, because needed mers to make it work. needed light chains instead of heavy chains. ========================== Analysis of internal (n-1)mer deletion sequences in synthetic oligodeoxyribonucleotides by hybridization to an immobilized probe array ....."The design of the probe array is dependent on the internal (n-1)mer sequences. For example, for the single base deletion sequences of the synthetic phosphorothioate oligodeoxyribonucleotide d(GCGTTTGCTCTTCTTCTTGCG), there are 14 possible different internal (n-1) deletion sequences (Table 1). " and....... ....."Two additional considerations were taken into account in design of the probes: (i) to maximize (n-1)mer discrimination, the mismatch location was placed as near to the center of the probe as possible; (ii) GC contents among probes were as similar as possible in order to obtain similar duplex stabilities. The probes used are listed in Table 2. " nar.oxfordjournals.org/content/27/2/389.full================================= Probes become the hybridization material. Bubble arc: www.pnas.org/content/98/20/11152/F2.large.jpg================ ENGINEERING SYNTHETIC VECTORS FOR IMPROVED DNA DELIVERY: Insights from Intracellular PathwaysABSTRACT Significant progress has been made in the area of nonviral gene delivery to date. Yet, synthetic vectors remain less efficient by orders of magnitude than their viral counterparts. Research continues toward unraveling and overcoming various barriers to the efficient delivery of DNA, whether in plasmid form encoding a gene or as an oligonucleotide for the selective inhibition of target gene expression. Novel components for overcoming these hurdles are continually being incorporated into the design of synthetic vectors, leading to increasingly more virus-like particles. Despite these advances, general principles defining the design of synthetic vectors are yet to be developed fully. A more quantitative analysis of the cellular uptake and intracellular processing of these vectors is required for the rational manipulation of vector design. Mathematical frameworks with a more conceptual basis will help obtain an integrated perspective on these complex systems. In this review, we critically examine the progress made toward the improved design of synthetic vectors by the strategic exploitation of intracellular mechanisms and explore newer possibilities to overcome obstacles in the practical realization of this field. www.annualreviews.org/doi/abs/10.1146/annurev.bioeng.6.040803.140203=============== so they are using viruses to achieve this, just as I thought, and the most used would be the influenza A which has the bird flu, swine flu, and the 1918 in its subparticles. They are all together, that is why there is a pandemic, of sorts, however, they are not all taking, it sounds like.
The synthetic ribosomes must be these? the are oligos.
synthetic phosphorothioate oligodeoxyribonucleotide d(GCGTTTGCTCTTCTTCTTGCG)
================ called anti sense, but can be delivered by magnetic field???
===================
Keywords:antisense oligonucleotides, magnetic field-guided nucleic acid delivery, magnetofection, endothelial NAD(P)H-oxidase, superoxide....." low-dose magnetic particle-bound ODN "........ ODN: antisense oligodesoxynucleotides (ODN)Magnetofection—A highly efficient tool for antisense oligonucleotide delivery in vitro and in vivowww.nature.com/mt/journal/v7/n5/full/mt200320a.html===================== antisense?
interferes with protein translation:en.wikipedia.org/wiki/File:Antisense_DNA_oligonucleotide.png================== Molecular biologists call a single strand of DNA sense (or positive (+) sense) if an RNA version of the same sequence is translated or translatable into protein. Its complementary strand is called antisense (or negative (-) sense). Sometimes the phrase coding strand is encountered; however, protein coding and non-coding RNA's can be transcribed similarly from both strands, in some cases being transcribed in both directions from a common promoter region, or being transcribed from within introns, on both strands (see "ambisense" below). Antisense DNA DNA normally has two strands, i.e., the sense strand and the antisense strand. In double-stranded DNA, only one strand codes for the RNA that is translated into protein. This DNA strand is referred to as the antisense strand. The strand that does not code for RNA is called the sense strand because it has a similar sequence to the messenger RNA (mRNA). Both the sense DNA strand and the mRNA transcript are complementary to the template DNA strand. Note that the DNA strands called "sense" and "antisense" are sometimes switched in older textbooks. Antisense molecules interact with complementary strands of nucleic acids, modifying expression of genes.en.wikipedia.org/wiki/Sense_%28molecular_biology%29======================== switched, so as to confuse, the synthetic ribosomal RNA in the Influena A, swine, bird, 1918 virion has antisense, or negative rRNA(ribosomal rna)
so the hybridization was done purposely using the original, M protein, M2 proton channel, MS2 phage, back in the 50s, so influenza would consistently be around to add, delete, these rRNAs which are nonsense, so they would be oligonucleotides. and POL 1, II and III are in the Pb1, pb2, the m is in the membrane of the virus, the beads on a string. skyship
|
|
|
Post by skyship on Feb 28, 2011 20:34:19 GMT -5
15 Antisense, non coding, synthetic negative ribosomal RNAs were found in the Influenza a virus. Someone(s) had to have put them there. They did not get there all by themselves. How does this relate to Morgellons? the M protein, is the beaded strand on inside membrane of the viral package or envelope. What is the M protein, that they cannot make a vaccine for? Also what are the 15 noncode, etc rRNAs? Chimeric cDNAs containing the coding region for the reporter chloramphenicol acetyltransferase (CAT) in an antisense orientation were flanked by the 5′- and 3′-terminal nontranslated regions of the UUK virus-sense RNA (vRNA) derived from the medium-sized (M) RNA segment. www.ncbi.nlm.nih.gov/pmc/articles/PMC136635/======================== there is an M RNA species. more later............ skyship
|
|
|
Post by aqt on Mar 1, 2011 18:32:11 GMT -5
|
|
|
Post by aqt on Mar 1, 2011 18:35:53 GMT -5
|
|
|
Post by aqt on Mar 1, 2011 18:41:17 GMT -5
|
|
|
Post by aqt on Mar 1, 2011 18:42:05 GMT -5
|
|
|
Post by skyship on Mar 1, 2011 19:30:13 GMT -5
found this snooping around the for the abstract. from your link.
Keywords:
* cage compounds; * dimerization; * GTPases; * light activation; * phytochrome proteins; * proteins
Thumbnail image of graphical abstract
Let there be light! Light control provides precise spatial and temporal regulation of cellular events. A genetically encoded system based on the photoswitchable Arabidopsis thaliana PhyB–PIF interaction has been applied to the reversible photocontrol of protein translocation and cellular morphology in mammalian cells.
the gtpases are in the cytoskeletal cell restructurings.
sky
|
|